Help icon

Detection Image Detection method details

Name:

QL-ELE-00-023

Description:

Qualitative real-time PCR (SYBRGreen) method for detection of T-35S pCAMBIA sequences (EU-RL GMFF GMOMETHODS database as of January 20, 2017)

Comment:

Target is the Cauliflower mosaic virus 35S terminator (CaMV T-35S) in pCAMBIA vector.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

element-specific

Target DNA element:

T-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    t35S pCAMBIA c-F
  • Sequence:

    cgggggatctggattttagta
  • Size:

    21
  • Reverse Primer

  • Name:

    t35S pCAMBIA a-R
  • Sequence:

    agggttcctatagggtttcgctc
  • Size:

    23
  • Amplicon:

  • Sequence:

    cgggggatctggattttagtactggattttggttttaggaattagaaattttattgatagaagtattttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaaccctataggaaccct
  • Size:

    137

Documents

Citation Type Local copy