Help icon

Detection Image Detection method details

Name:

QL-ELE-00-021

Description:

Qualitative real-time PCR (SYBRGreen) method for detection of CS-pat-STRVR (Barbau-Piednoir et al., 2014)

Comment:

Target is CS-pat-STRVR from Streptomyces viridochromogenes

Validation:

ring trial validation

Standardisation:

unknown

Related Methods:

QL-TAX-BN-003, QL-TAX-GM-001, QL-TAX-ZM-002

Type:

element-specific

Target DNA element:

CS-pat-STRVR
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Pat-Pat Fwd
  • Sequence:

    CCGCGGTTTGTGATATCGTT
  • Size:

    20
  • Reverse Primer

  • Name:

    Pat-Pat Rev
  • Sequence:

    TCTTGCAACCTCTCTAGATCATCAA
  • Size:

    25
  • Amplicon:

  • Sequence:

    ccgcggtttgtgatatcgttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttgatgatctagagaggttgcaaga
  • Size:

    109

Documents

Citation Type Local copy
Barbau-Piednoir, E., Stragier, P., Roosens, N., Mazzara, M., Savini, C., Van den Eede, G., Van den Bulcke, M. (2014). Inter-laboratory testing of GMO detection by combinatory SYBR®Green PCR screening (CoSYPS). Food Analytical Methods. 7, 1719-1728.Link to the document url. peer-reviewed article
Barbau-Piednoir, E. et al. (2012). Four new SYBR_Green qPCR screening methods for the detection of Roundup Ready, LibertyLink, and CryIAb traits in genetically modified products. Eur Food Res Technol, 234, 13–23.Link to the document url. peer-reviewed article 09-01-2015
EU-RL GMFF GMOMETHODS database; QL-ELE-00-021Link to the document url. EU reference method protocol