Help icon

Detection Image Detection method details

Name:

QL-ELE-00-017

Description:

Qualitative real-time PCR (SYBRGreen) method for detection of P-35S CaMV (Barbau-Piednoir et al., 2014)

Comment:

Target is the P-35S CaMV from Cauliflower mosaic virus

Validation:

ring trial validation

Standardisation:

unknown

Related Methods:

QL-TAX-BN-003, QL-TAX-GM-001, QL-TAX-ZM-002

Type:

element-specific

Target DNA element:

P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S_N3Fwd
  • Sequence:

    AAAGCAAGTGGATTGATGTGATA
  • Size:

    23
  • Reverse Primer

  • Name:

    35S_N3Rev
  • Sequence:

    GGGTCTTGCGAAGGATAGTG
  • Size:

    20
  • Amplicon:

  • Sequence:

    aaagcaagtggattgatgtgatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncactatccttcgcaagaccc
  • Size:

    75

Documents

Citation Type Local copy
Barbau-Piednoir, E., Stragier, P., Roosens, N., Mazzara, M., Savini, C., Van den Eede, G., Van den Bulcke, M. (2014). Inter-laboratory testing of GMO detection by combinatory SYBR®Green PCR screening (CoSYPS). Food Analytical Methods. 7, 1719-1728.Link to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QL-ELE-00-017Link to the document url. EU reference method protocol