Help icon

Detection Image Detection method details

Name:

QL-ELE-00-015

Description:

Qualitative real-time PCR (TaqMan) method for detection of figwort mosaic virus 34S promoter (ISO/TS 21569-5).

Comment:

Target is the figwort mosaic virus 34S promoter (P-FMV) which in some GMO is indicated as figwort mosaic virus 34S enhancer (E-FMV).

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

E-FMV, P-FMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    pFMV-F
  • Sequence:

    CAAAATAACGTGGAAAAGAGCT
  • Size:

    22
  • Reverse Primer

  • Name:

    pFMV-R
  • Sequence:

    TCTTTTGTGGTCGTCACTGC
  • Size:

    20
  • Probe

  • Name:

    Probe pFMV
  • Sequence:

    CTGACAGCCCACTCACTAATGC
  • Size:

    22
  • Amplicon:

  • Sequence:

    caaaataacgtggaaaagagctnnnctgacagcccactcactaatgcnnnnnnnnnnngcagtgacgaccacaaaaga
  • Size:

    78

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-ELE-00-015Link to the document url. EU reference method protocol