Help icon

Detection Image Detection method details

Name:

QL-ELE-00-011

Description:

Qualitative real-time PCR (TaqMan) method for detection of nopaline synthase terminator (ISO 21569 AMD1)

Comment:

target is the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

T-nos-RHIRD
  • Oligonucleotides:

  • Forward Primer

  • Name:

    180-F
  • Sequence:

    catgtaatgcatgacgttatttatg
  • Size:

    25
  • Reverse Primer

  • Name:

    180-R
  • Sequence:

    ttgttttctatcgcgtattaaatgt
  • Size:

    25
  • Probe

  • Name:

    Tm-180
  • Sequence:

    atgggtttttatgattagagtcccgcaa
  • Size:

    28
  • Amplicon:

  • Sequence:

    catgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaa
  • Size:

    84

Documents

Citation Type Local copy
Reiting R., Broll H., Waiblinger H.-U., Grohmann L.; Collaborative Study of a T-nos Real-Time PCR Method for Screening of Genetically Modified Organisms in Food Products J. Verbr. Lebensm. 2:116-121 (2007)Link to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QL-ELE-00-011Link to the document url. EU reference method protocol