Help icon

Detection Image Detection method details

Name:

QL-ELE-00-004

Description:

Qualitative conventional PCR method for detection of Cauliflower Mosaic Virus 35S promoter (Lipp et al., 2001)

Comment:

Target is the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-cf3
  • Sequence:

    CCACGTCTTCAAAGCAAGTGG
  • Size:

    21
  • Reverse Primer

  • Name:

    35S-cr4
  • Sequence:

    TCCTCTCCAAATGAAATGAACTTCC
  • Size:

    25
  • Amplicon:

  • Sequence:

    ccacgtcttcaaagcaagtggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggaagttcatttcatttggagagga
  • Size:

    123

Documents

Citation Type Local copy
Lipp M., Bluth A., Eyquem F., Kruse L., Schimmel H., Van den Eede G., Anklam E.; Validation of a method based on polymerase chain reaction for the detection of genetically modified organisms in various processed foodstuffs Eur. Food Res. Technol. 212:49Link to the document url. peer-reviewed article
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods ISO 21569:1-69 (2005)Link to the document url. other document
EU-RL GMFF GMOMETHODS database; QL-ELE-00-004Link to the document url. EU reference method protocol