Help icon

Detection Image Detection method details

Name:

QL-CON-p-nos-F2/NPTII-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the nopaline synthase promoter (P-nos)and the neomycin phosphotransferase II gene (nptII) (ISO/TS 21569-4)

Comment:

target is the junction region of a construct of the nopaline synthase promoter(P-nos) from Agrobacterium tumefaciens and the neomycin phosphotransferase II (nptII) gene from Escherichia coli (amplicon in event Ms1 is 151 bp)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

construct-specific

Target GMO names:

1345-4, 16-0-1, 18-2-4, 35 1 N, 55-1, 63-1, B tomato, C5, Da tomato, EH92-527-1, F tomato, F3'5'H GM petunia, FP967, GD743, GFM Cry1A, GS784, HLMT15-15, HLMT15-3, HLMT15-46, Huanong No. 1, INI-FMAPDF, KMD1, MPS965, Melon A, Melon B, Ms1, NF872, RBMT15-101, RBMT21-129, RBMT21-152, RBMT21-350, RL01-15, RL01-17, RM3-3, RM3-4, RM3-6, Rf1, Rf2, SEMT15-02, SEMT15-15, T120-7, Topas 19/2, X17-2, dfr GM petunia
  • Oligonucleotides:

  • Forward Primer

  • Name:

    p-nos-F2
  • Sequence:

    TTCCCCTCGGTATCCAATTAGAG
  • Size:

    23
  • Reverse Primer

  • Name:

    NPTII-R
  • Sequence:

    GATTGTCTGTTGTGCCCAGTCA
  • Size:

    22
  • Probe

  • Name:

    NPTII-Tm2
  • Sequence:

    AGCCGAATAGCCTCTCCACCCAAGC
  • Size:

    25
  • Amplicon:

  • Sequence:

    ttcccctcggtatccaattagagtctcatattcactctcaatccagatccggcccatgatcatgtggattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatc
  • Size:

    151

Documents

Citation Type Local copy