Help icon

Detection Image Detection method details

Name:

QL-CON-gat/T-pinII-F/gat/T-pinII-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the gat gene and pinII terminator (Prins et al., 2016)

Comment:

Target is the junction between between the Bacillus licheniformis glyphosate-N-acetyltransferase (CS-gat- BACLI) gene and the proteinase inhibitor II (T-pinII-SOLTU) terminator from Solanum tuberosum.

Amplicon represented by maize 98140 (GenBank KP784699) is 112 nt instead of the published 111 nt.

Validation:

in-house validation

Standardisation:

national standard

Related Methods:

Type:

construct-specific

Target GMO names:

61061, 73496, 98140, DP356043
  • Oligonucleotides:

  • Forward Primer

  • Name:

    gat/T-pinII-F
  • Sequence:

    GGACCTCACATCCTGATGTATAA
  • Size:

    23
  • Reverse Primer

  • Name:

    gat/T-pinII-R
  • Sequence:

    GCATCCTTTTATTTCATACATTA
  • Size:

    23
  • Probe

  • Name:

    gat/T-pinII-P
  • Sequence:

    CCATCTTCTGGATTGGCCAACTTAA
  • Size:

    25
  • Amplicon:

  • Sequence:

    GGACCTCACATCCTGATGTATAAGAGGATCACATAACTAGCTAGTCAGTTAACCTAGACTTGTCCATCTTCTGGATTGGCCAACTTAATTAATGTATGAAATAAAAGGATGC
  • Size:

    112

Documents

Citation Type Local copy
Prins, T.W., van Hoof, R.A., Scholtens, I.M.J., Kok, E.J. (2016). Novel TaqMan PCR screening methods for element cry3A and construct gat/T‑pinII to support detection of both known and unknown GMOs. Eur Food Res Technol, 243, 481–488.Link to the document url. peer-reviewed article 18-08-2016pdf