Help icon

Detection Image Detection method details

Name:

QL-CON-cptiF2/tNOS-uni-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the cpti gene and nos terminator (Reiting et al., 2010)

Comment:

Target is the junction between between the cow pea trypsin inhibitor (cpti) gene and the nopaline synthase gene terminator (T-nos)from Agrobacterium tumefaciens

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

construct-specific

Target GMO names:

Kefeng6
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cptiF2
  • Sequence:

    caagtccagggatgaagatgatgag
  • Size:

    25
  • Reverse Primer

  • Name:

    tNOS-uni-R
  • Sequence:

    gcttaacgtaattcaacagaaattatatgataat
  • Size:

    34
  • Probe

  • Name:

    tNOS-uni-Tm
  • Sequence:

    tcgcaagaccggcaacaacaggattc
  • Size:

    23
  • Amplicon:

    unknown

Documents

Citation Type Local copy
Reiting R, Grohmann L, Maede D (2010) A testing cascade for the detection of genetically modified rice by real-time PCR in food and its application for detection of an unauthorized rice line similar to KeFeng6. J. Verbr. Lebensm. 5:185-188Link to the document url. peer-reviewed article 04-05-2016