Help icon

Detection Image Detection method details

Name:

QL-CON-PGS-bar-A2/PGS-bar-B2

Description:

Qualitative conventional PCR method for detection of the junction between P-SSU promoter and the bar gene (BVL G30.40-13)

Comment:

Target is the junction region between the small subunit promoter (P-SSU) from Arabidopsis thaliana and the phosphinothricin acetyltransferase gene (bar) from Streptomyces hygroscopicus (BVL G30.40-13)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

construct-specific

Target GMO names:

Ms1, Ms11, Ms8, RM3-3, RM3-4, RM3-6, Rf1, Rf2, Rf3
  • Oligonucleotides:

  • Forward Primer

  • Name:

    PGS-bar-A2
  • Sequence:

    gaagttgaccgtgcttgtct
  • Size:

    20
  • Reverse Primer

  • Name:

    PGS-bar-B2
  • Sequence:

    caagtccaccaggcaagtaa
  • Size:

    20
  • Amplicon:

    unknown

Documents

Citation Type Local copy
PCR detection of the pSSUAra-bar construct for screening of genetically modified oilseed rape lines - construct-specific method. BVL Official Method Collection G 30.40-13 Online Publication (2015)Link to the document url. other document 04-05-2016