Help icon

Detection Image Detection method details

Name:

QL-CON-MDB498 /DPA143

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the 35S promoter and the bar gene (Bayer CropScience, 2006)

Comment:

target is the junction between the 35S promoter (P-35S) from CaMV and the phosphinothricin N-acetyltransferase (bar) gene from Streptomyces hygroscopicus

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

construct-specific

Target GMO names:

B16 (DLL25), Bt176, CBH351, DBT418, LLCotton25, LLRICE06, LLRICE601, LLRICE604, LLRICE62, MON88701, Ms3, Ms6, T1c-19, T303-3, T304-40, TC6275, W62, W98
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MDB498
  • Sequence:

    TATCCTTCGCAAGACCCTTCC
  • Size:

    21
  • Reverse Primer

  • Name:

    DPA143
  • Sequence:

    ATGTCGGCCGGGCGTCGTTCTG
  • Size:

    22
  • Probe

  • Name:

    TM099
  • Sequence:

    TCTATATAAGGAAGTTCATTTCATT
  • Size:

    25
  • Amplicon:

  • Sequence:

    tatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacagggtaccggatccaacaatgagcccagaacgacgcccggccgacat
  • Size:

    103

Documents

Citation Type Local copy
Grain testing method for the detection of rice GM events containing 35S::bar sequences using RT-PCR protocols PGS0494 and PGS0476. (2006) Bayer CropScience. BioScience 31-8-2006, Ghent, BelgiumLink to the document url.