Detection Image Detection method details

  • Name:

    QL-CON-GH-tFreeze-F/GH-tFreeze-R
  • Description:

    Qualitative real-time PCR (TaqMan) method for detection of the junction between the growth hormone gene and the antifreeze terminator present in AquAdvantage Salmon (Debode et al., 2018)
  • Comment:

    Target is the junction region between the growth hormone gene (CS-GHc2) sequence from Oncorhynchus tshawytscha and the antifreeze terminator (T-AFP) from Zoarces americanus
  • Validation:

    in-house validation
  • Standardisation:

    none
  • Help icon

    Related Methods:

  • Type:

    construct-specific
  • Target GMO names:

    AquAdvantage Salmon
  • Oligonucleotides:

  • Forward Primer

  • Name:

    GH-tFreeze-F
  • Sequence:

    ctccacaggttttgacatgttca
  • Size:

    23
  • Reverse Primer

  • Name:

    GH-tFreeze-R
  • Sequence:

    gccagcaagagcccatctc
  • Size:

    19
  • Probe

  • Name:

    GH-tFreeze-P
  • Sequence:

    ttcctaatctgtatctgggaaaccgaaccct
  • Size:

    31
  • Amplicon:

  • Sequence:

    ctccacaggttttgacatgttcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagatgggctcttgctggc
  • Size:

    75

Documents

Citation Type Local copy
Protocol QL-CON-GH-tFreeze-F/GH-tFreeze-R, Debode et al. 2017 PCR Protocol pdf
Debode F., Janssen E., Marien A. et al. (2018) Detection of transgenic atlantic and Coho Salmon by real-time PCR. Food Analytical Methods,11(9),2396–2406Link to the document url. peer-reviewed article 31-10-2018