Help icon

Detection Image Detection method details

Name:

QL-CON-CP1/pFMV2

Description:

Qualitative conventional PCR method for detection of the junction between the FMV promoter and the cp4-epsps gene (BVL G30.40-11)

Comment:

Target is the junction region between the Figwort mosaic virus promoter (P-FMV) and the epsps gene from Agrobacterium tumefaciens strain CP4 (cp4-epsps)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

construct-specific

Target GMO names:

GT200, GT73, GTSB77, H7-1, J101, J163, MON1445, MON1698, MON87705, MON88302, MON88913, MON89788, RBMT22-082, RBMT22-186, RBMT22-238, RBMT22-262, ZSR500, ZSR502, ZSR503
  • Oligonucleotides:

  • Forward Primer

  • Name:

    CP1
  • Sequence:

    gacttacgagcagttgctggacggctgc
  • Size:

    28
  • Reverse Primer

  • Name:

    pFMV2
  • Sequence:

    cctgacagcccactcactaatgcgtatg
  • Size:

    28
  • Amplicon:

  • Sequence:

    cctgacagcccactcactaatgcgtatgacgaacgcagtgacgaccacaaaagaattccctctatataagaaggcattcattcccatttgaaggatcatcagatactcaaccaatccttctagaagatctaagcttatcgataagcttgatgtaattggaggaagatcaaaattttcaatccccattcttcgattgcttcaattgaagtttctccgatggcgcaagttagcagaatctgcaatggtgtgcagaacccatctcttatctccaatctctcgaaatccagtcaacgcaaatctcccttatcggtttctctgaagacgcagcagcatccacgagcttatccgatttcgtcgtcgtggggattgaagaagagtgggatgacgttaattggctctgagcttcgtcctcttaaggtcatgtcttctgtttccacggcgtgcatgcttcacggtgcaagcagccgtccagcaactgctcgtaagtc
  • Size:

    488

Documents

Citation Type Local copy
PCR detection of the pFMV-CP4EPSPS construct for screening of genetically modified plants - construct-specific method. BVL Official Method Collection G 30.40-11 Online Publication (2015)Link to the document url. other document 04-05-2016