Help icon

Detection Image Detection method details

Name:

QL-CON-35S-F/nptII-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the CaMV 35S promoter and the nptII gene (Reiting, 2010)

Comment:

Target is the junction region between the Cauliflower mosaic virus (CaMV) 35S promoter (P-35S) and the neomycin phophotransferase II (nptII) gene

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

construct-specific

Target GMO names:

23-18-17, 23-198, 31807, 31808, 5345, 8338, ATBT04-06, ATBT04-27, ATBT04-30, ATBT04-31, ATBT04-36, BT10 potato, BT12 potato, BT16 potato, BT17 potato, BT18 potato, BT23 potato, BT6 potato, BXN10211, CZW-3, MON1076, MON1445, MON15985, MON1698, MON531, MON757, MON863, MON87460, SPBT02-7, ZW20
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-F
  • Sequence:

    tatccttcgcaagacccttcc
  • Size:

    21
  • Reverse Primer

  • Name:

    nptII-R
  • Sequence:

    gattgtctgttgtgcccagtca
  • Size:

    22
  • Probe

  • Name:

    nptII-Tm2
  • Sequence:

    agccgaatagcctctccacccaagc
  • Size:

    25
  • Amplicon:

  • Sequence:

    tatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacacgctgaaatcaccagtctctctctacaagatcggggatctctagctagacgatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatc
  • Size:

    205

Documents

Citation Type Local copy