Help icon

Detection Image Detection method details

Name:

QL-CON-00-013

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the maize ubiquitin promoter and the modified cry1Ab/1Ac genes (Grohmann et al.,2015)

Comment:

target is the junction region between the ubiquitin promoter (P-ubi) sequence from maize (Zea mays) and the cry1Ab/Ac genes from Bacillus thuringiensis

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

construct-specific

Target GMO names:

3006-210-23, 4114, DAS1507, DAS59122, DAS59132, KMD1, Kefeng6
  • Oligonucleotides:

  • Forward Primer

  • Name:

    pubi-F2
  • Sequence:

    atttgcttggtactgtttcttttgtc
  • Size:

    26
  • Reverse Primer

  • Name:

    cry-rr-R
  • Sequence:

    ttgttgtccatggatcctctagagt
  • Size:

    25
  • Probe

  • Name:

    pubi-T2
  • Sequence:

    accctgttgtttggtgttacttctgca
  • Size:

    27
  • Amplicon:

  • Sequence:

    atttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgcaggtcgactctagaggatccatggacaacaa
  • Size:

    90

Documents

Citation Type Local copy
Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., Jit Randhawa G., Zur K. Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products. Accred Qual Assur 20:85-96 (2015)Link to the document url. peer-reviewed article