Help icon

Detection Image Detection method details

Name:

QL-CON-00-012

Description:

Qualitative real-time PCR (TaqMan) method for detection of papaya event 55-1 and 63-1 (ISO 21569)

Comment:

Target is the junction region between the cauliflower mosaic virus 35S promoter (P-35S CaMV) and the chimeric cucumber mosaic virus coat protein/papaya ring spot virus coat protein

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

construct-specific

Target GMO names:

55-1, 63-1
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-F
  • Sequence:

    GACGTAAGGGATGACGCACAA
  • Size:

    21
  • Reverse Primer

  • Name:

    sunup-ar1
  • Sequence:

    ACGTCGTCAGTCCAAGAATGA
  • Size:

    21
  • Probe

  • Name:

    35S -T
  • Sequence:

    CCCACTATCCTTCGCAAGACCCTTCC
  • Size:

    26
  • Amplicon:

  • Sequence:

    gacgtaagggatgacgcacaancccactatccttcgcaagacccttccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacgtcgtcagtccaagaatga
  • Size:

    220

Documents

Citation Type Local copy