Help icon

Detection Image Detection method details

Name:

QL-CON-00-011

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the 35S promoter and the phosphinothricin N-acetyltransferase (pat) gene (G 30.40-1).

Comment:

target is the junction region between the 35S promoter (P-35S) from the Cauliflower mosaic virus and a modified phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes (the amplicon size may vary depending on the P35S-pat construct present in the event, e.g. in DAS59122 it is 102 bp long).

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

construct-specific

Target GMO names:

32316, 40416, 4114, 676, 678, 680, A2704-12, A2704-21, A5547-127, A5547-35, Bt10 maize, Bt11, DAS1507, DAS59122, DAS59132, Falcon GS 40/90, GU262, HCN10, Liberator, MZHG0JG, MZIR098, SYHT0H2, T120-7, T14, T25, T45, Topas 19/2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35SP03.f
  • Sequence:

    aagttcatttcatttggagaggaca
  • Size:

    25
  • Reverse Primer

  • Name:

    pat-7.r
  • Sequence:

    cggccatatcagctgctgtag
  • Size:

    21
  • Probe

  • Name:

    GSS01.s
  • Sequence:

    ccggagaggagaccagttgagattaggc
  • Size:

    28
  • Amplicon:

  • Sequence:

    aagttcatttcatttggagaggacannnnnnnnnnnnnnnnnnnnnnnnnccggagaggagaccagttgagattaggcnnnctacagcagctgatatggccg
  • Size:

    102

Documents

Citation Type Local copy
Methodensammlung des Länderausschusses Gentechnik. Real-Time PCR zur quantitativen Bestimmung gentechnisch veränderter Rapslinien mit dem 35S/pat-Genkonstrukt. Erstellt vom Unterausschuss Methodenentwicklung; Stand 24.03.2006. 9 pp.Link to the document url. EU reference method protocol
EU-RL GMFF GMOMETHODS database; QL-CON-00-011Link to the document url. EU reference method protocol
Real-Time PCR zur quantitativen Bestimmung gentechnisch veränderter Rapslinien mit dem 35S/pat-GenkonstruktLink to the document url. EU reference method protocol 30-03-2012