Help icon

Detection Image Detection method details

Name:

QL-CON-00-010

Description:

Qualitative real-time PCR (TaqMan) method for detection of a construct present in flax event FP967 (ISO 21569-2)

Comment:

Target is the junction region between the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens and the dihydrofolate reductase (dhfr) gene from Escherichia coli

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QT-TAX-SAD-FW/SAD-RV

Type:

construct-specific

Target GMO names:

FP967
  • Oligonucleotides:

  • Forward Primer

  • Name:

    NOST-Spec FW
  • Sequence:

    AGCGCGCAAACTAGGATAAA
  • Size:

    20
  • Reverse Primer

  • Name:

    NOST-Spec RV
  • Sequence:

    ACCTTCCGGCTCGATGTCTA
  • Size:

    20
  • Probe

  • Name:

    NOST-Spec Probe
  • Sequence:

    CGCGCGCGGTGTCATCTATG
  • Size:

    20
  • Amplicon:

  • Sequence:

    agcgcgcaaactaggataaannnncgcgcgcggtgtcatctatgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagacatcgagccggaaggt
  • Size:

    105

Documents

Citation Type Local copy
Horizontal methods for molecular biomarker analysis - Methods of analysis for the detection of genetically modified organisms and derived products - Part 2: Construct-specific real-time PCR method for detection of event FP967 in linseed and linseed products (ISO/TS 21569-2)Link to the document url. unknown 11-05-2016
EU-RL GMFF GMOMETHODS database; QL-CON-00-010Link to the document url. EU reference method protocol