Help icon

Detection Image Detection method details

Name:

QL-CON-00-008

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the chloroplast transit peptide 2 and the CP4 epsps gene (ISO 21569 AMD1).

Comment:

target is the junction region between the chloroplast transit peptide 2 (CTP2) sequence from the Arabidopsis thaliana epsps gene and the CP4 epsps gene from Agrobacterium tumefaciens (CP4 EPSPS)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

construct-specific

Target GMO names:

ASR368, GT200, GT73, GTSB77, H7-1, J101, J163, MON1445, MON1698, MON71200, MON71700, MON71800, MON80100, MON802, MON809, MON832, MON87411, MON87427, MON87705, MON88017, MON88302, MON88913, MON89788, NK603, RBMT22-082, RBMT22-186, RBMT22-238, RBMT22-262, ZSR500, ZSR502, ZSR503
  • Oligonucleotides:

  • Forward Primer

  • Name:

    GT73-TmF
  • Sequence:

    GGGATGACGTTAATTGGCTCTG
  • Size:

    22
  • Reverse Primer

  • Name:

    GT73-TmR
  • Sequence:

    GGCTGCTTGCACCGTGAAG
  • Size:

    19
  • Probe

  • Name:

    GT73-TmP
  • Sequence:

    CACGCCGTGGAAACAGAAGACATGACC
  • Size:

    27
  • Amplicon:

  • Sequence:

    gggatgacgttaattggctctgagcttcgtcctcttaaggtcatgtcttctgtttccacggcgtgcatgcttcacggtgcaagcagcc
  • Size:

    88

Documents

Citation Type Local copy
Grohmann L., Brunen-Nieweler C., Nemeth A., Waiblinger H.U.; Collaborative trial validation studies of real-time PCR-based GMO screening methods for detection of the bar gene and the ctp2-cp4epsps construct J. Agric. Food Chem. 57:8913-8920 (2009)Link to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QL-CON-00-008Link to the document url. EU reference method protocol