Help icon

Detection Image Detection method details

Name:

QL-CON-00-006

Description:

Qualitative conventional PCR method for detection of soybean event GTS-40-3-2 (ISO 21569)

Comment:

Target is the junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast-transit-peptide (CTP) sequence from Petunia hybrida epsps gene

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QL-TAX-GM-008

Type:

construct-specific

Target GMO names:

GTS 40-3-2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    p35S-af2
  • Sequence:

    TGATGTGATATCTCCACTGACG
  • Size:

    22
  • Reverse Primer

  • Name:

    petu-ar1
  • Sequence:

    TGTATCCCTTGAGCCATGTTGT
  • Size:

    22
  • Amplicon:

  • Sequence:

    tgatgtgatatctccactgacgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacaacatggctcaagggataca
  • Size:

    172

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-CON-00-006Link to the document url. EU reference method protocol