Help icon

Detection Image Detection method details

Name:

QL-CON-00-005

Description:

Qualitative conventional PCR method for detection of maize event T25 (ISO 21569)

Comment:

Target is the junction region between the phosphinothricin N-acetyltransferase (CS-pat-STRVR) gene from Streptomyces viridochromogenes and the cauliflower mosaic virus 35S terminator (T-35S-CaMV)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QL-TAX-ZM-003

Type:

construct-specific

Target GMO names:

32316, 40416, 4114, 678, 680, A2704-12, A2704-21, A5547-127, A5547-35, DAS1507, DAS59122, DAS59132, Falcon GS 40/90, GU262, HCN10, HCR-1, Liberator, T120-7, T14, T25, T45, Topas 19/2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T25-F7
  • Sequence:

    ATGGTGGATGGCATGATGTTG
  • Size:

    21
  • Reverse Primer

  • Name:

    T25-R3
  • Sequence:

    TGAGCGAAACCCTATAAGAACCC
  • Size:

    23
  • Amplicon:

  • Sequence:

    atggtggatggcatgatgttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggttcttatagggtttcgctca
  • Size:

    209

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-CON-00-005Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods ISO 21569:1-69 (2005)Link to the document url. other document